View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11940_low_38 (Length: 349)
Name: NF11940_low_38
Description: NF11940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11940_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 125 - 340
Target Start/End: Original strand, 41763045 - 41763258
Alignment:
| Q |
125 |
caacgtacattctttcccctccgaagaaaactcaaatttggggagcaaaatgcagggctgaccctacgcataggtggggagtgtgacggccgaaggctta |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41763045 |
caacgtacattctttcccctccgaagaaaactcaaatttggggagcaaaatgcagggctgaccctacgcataggtggggagtgcgacggccgaaggctta |
41763144 |
T |
|
| Q |
225 |
ggtccgtaattttttcatagggggtatatatacaacaaagtttattttattggtggggtatatatatcaaatcgttcaaatgggcccaaagccttgtctt |
324 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
41763145 |
ggtccataatttttttatagggggtatatatacaac--agtttattttattggtggggtatatatatcaaatcgtacaaatgggcccaaatccttgtctt |
41763242 |
T |
|
| Q |
325 |
ggcccatgatgtccat |
340 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41763243 |
ggcccatgatgtccat |
41763258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 41762932 - 41762992
Alignment:
| Q |
12 |
gagaaggacgacgtacatgaaggtcaagacgggtaacaaaaatttagtaaggacaactttg |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41762932 |
gagaaggacgacgtacatgaaggtcaagacaggtaacaaaaattcagtaaggacaactttg |
41762992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University