View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11940_low_42 (Length: 302)
Name: NF11940_low_42
Description: NF11940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11940_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 287
Target Start/End: Original strand, 36381024 - 36381300
Alignment:
| Q |
11 |
cacagaggttgctgcttctattggttatgctttggacatgccagctgatgaaagggaaaaacggcatcagtttaatttcaagcatgtgacaactcacaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36381024 |
cacagaggttgctgcttctattggttatgctttggacatgccagctgatgaaagggaaaaacggcatcagtttaatttcaagcatgtgacaactcacacg |
36381123 |
T |
 |
| Q |
111 |
tcacaagaatgggctgcaacttttgttaggttttaatcctccaactatgcttgcctcttgtttttcttgaataagttttgttccttgccttttttccctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36381124 |
tcacaagaatgggctgcaacttttgttaggttttaatcctccaactatgcttgccttttgttttttttgaataagttttgttccttgccttttttccctt |
36381223 |
T |
 |
| Q |
211 |
gtaaacccacagtgaggtgaaacagttttaaatgacttttagactgctgataaccgactttcaattacattgttttt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
36381224 |
gtaaacccacagtgaggtgaaacagttttaaatgacttttagactgctgttaaccgactttcaattacactgttttt |
36381300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University