View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11941_high_6 (Length: 242)
Name: NF11941_high_6
Description: NF11941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11941_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 10120787 - 10121005
Alignment:
| Q |
19 |
actttatgggacttttggatgatgaaaccatggagaatatgggatactcaaacaaaaaccaagcaaatatcattgttggtttcattgatacaggtaggaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10120787 |
actttatgggacttttggatgatgaaaccatggagaatatgggatactcaaacaaaaaccaagcaaatgttattgttggtttcattgatacaggtg---- |
10120882 |
T |
 |
| Q |
119 |
ttcttattcttagagtatggtgatgcctttttgataacttctatgtaactataccttcattctcacgtacaacatgcaccttttcttagaagtctcgtga |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10120883 |
-tcgtattcttagagtatggtgatgcctttttgataacttctatgtaactataccttcattctcacgtacaacatgcaccttttcttagaagtctcgtga |
10120981 |
T |
 |
| Q |
219 |
aaacatttattagtcggttttcac |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10120982 |
aaacatttattagtcggttttcac |
10121005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 30629925 - 30629840
Alignment:
| Q |
24 |
atgggacttttggatgatgaaaccatggagaatatgggatactcaaacaaaaaccaagcaaatatcattgttggtttcattgatac |
109 |
Q |
| |
|
||||||||||| |||||| |||||||||| | | | || |||||| ||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
30629925 |
atgggacttttagatgatcaaaccatggaaactcttggctactcagttaaaaatcaagaaaatatcatcattggtttcattgatac |
30629840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University