View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11941_low_5 (Length: 253)
Name: NF11941_low_5
Description: NF11941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11941_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 29083397 - 29083610
Alignment:
| Q |
1 |
tggtttggttttggccttctggtttggctgtgttttagctactggtcttctggtatatcagagacctgtgttatgtatgttctgcctgcgtgtttttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29083397 |
tggtttggttttggccttctggtatggctgttttttagctactggtcttctggtatatcagagacctgtgttatgtatgttctgcctgcgtg-ttttgtt |
29083495 |
T |
 |
| Q |
101 |
gtgttgcttaaacactcgcg-cataataatatttgctgattctaatnnnnnnnngtaactttattaagtagacactattaaatttgtttctaacaagttg |
199 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29083496 |
gtgttgcttacacactcgcgccgtaataatatttgctgattctaaaaaaaaaaagtaactttattaagtaaacactattaaatttgtttctaacaagtta |
29083595 |
T |
 |
| Q |
200 |
gaaaacgcatatgaa |
214 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
29083596 |
gaaaacacatatgaa |
29083610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University