View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11941_low_6 (Length: 242)

Name: NF11941_low_6
Description: NF11941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11941_low_6
NF11941_low_6
[»] chr5 (1 HSPs)
chr5 (19-242)||(10120787-10121005)
[»] chr8 (1 HSPs)
chr8 (24-109)||(30629840-30629925)


Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 10120787 - 10121005
Alignment:
19 actttatgggacttttggatgatgaaaccatggagaatatgggatactcaaacaaaaaccaagcaaatatcattgttggtttcattgatacaggtaggaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||         
10120787 actttatgggacttttggatgatgaaaccatggagaatatgggatactcaaacaaaaaccaagcaaatgttattgttggtttcattgatacaggtg---- 10120882  T
119 ttcttattcttagagtatggtgatgcctttttgataacttctatgtaactataccttcattctcacgtacaacatgcaccttttcttagaagtctcgtga 218  Q
     || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10120883 -tcgtattcttagagtatggtgatgcctttttgataacttctatgtaactataccttcattctcacgtacaacatgcaccttttcttagaagtctcgtga 10120981  T
219 aaacatttattagtcggttttcac 242  Q
    ||||||||||||||||||||||||    
10120982 aaacatttattagtcggttttcac 10121005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 30629925 - 30629840
Alignment:
24 atgggacttttggatgatgaaaccatggagaatatgggatactcaaacaaaaaccaagcaaatatcattgttggtttcattgatac 109  Q
    ||||||||||| |||||| |||||||||| | | | || ||||||   ||||| |||| |||||||||  ||||||||||||||||    
30629925 atgggacttttagatgatcaaaccatggaaactcttggctactcagttaaaaatcaagaaaatatcatcattggtttcattgatac 30629840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University