View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_high_39 (Length: 252)
Name: NF11942_high_39
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 43 - 236
Target Start/End: Complemental strand, 28735588 - 28735395
Alignment:
| Q |
43 |
aaccatgggaatattaagtatgcatctttacctatcaaataagtagaaatcactgtgtgctttctcctgcaaaatacaatctccaacataagaaaaaatt |
142 |
Q |
| |
|
|||| ||| ||||||||||| |||||||| |||||||||| || ||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28735588 |
aaccttggaaatattaagtaggcatctttccctatcaaattagcagaaatctttgagtgctttctcctgcaaaatacaatctccaacataagaaaaaatt |
28735489 |
T |
 |
| Q |
143 |
gcatcatattaaaagtatttgcagtagatttagcccgacttcaacttaatcgatgcgtaaattcctggacgtggaatatctttaaaatctaaag |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |||||||||| || |||||||| ||||||||||||| |
|
|
| T |
28735488 |
gcatcatatgaaaagtatttgcagtagatttatcctgacttcaacttaatcgatgcaaaaattcctggccgcggaatatcattaaaatctaaag |
28735395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 76
Target Start/End: Complemental strand, 28730904 - 28730842
Alignment:
| Q |
14 |
gaaaaccaaccaaaatgtaaaacacagtaaaccatgggaatattaagtatgcatctttaccta |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730904 |
gaaaaccaaccaaaatgtaaaacacagtaaaccatgggaatattaagtatgcatctttaccta |
28730842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University