View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_high_49 (Length: 234)
Name: NF11942_high_49
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_high_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 9 - 136
Target Start/End: Complemental strand, 13006801 - 13006674
Alignment:
| Q |
9 |
agagagaagaaacaaatatactatatcttgtggattagaaagctaatgcatggatttttgttttgttaactatgttattgttattggtgtaaagtattcg |
108 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13006801 |
agagacaagaaacaaatatactatttcttgtggattagaaaactaatgcatggatttttgttttgttaactatgttattgttattggtgtaaactattcg |
13006702 |
T |
 |
| Q |
109 |
ccaactttgttgatgactagtctctgtt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13006701 |
ccaactttgttgatgactagtctctgtt |
13006674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 136 - 217
Target Start/End: Complemental strand, 13006484 - 13006403
Alignment:
| Q |
136 |
tagagaacacatgatatttgatcactaagttcagccaattatgcttaggtctccgactgaagagcagctacaatatctttct |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13006484 |
tagagaacacatgatatttgatcacaaagttcagccaattatgcttaggtcttcgactgaagagcagctacaatatctttct |
13006403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University