View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_10 (Length: 520)
Name: NF11942_low_10
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 311
Target Start/End: Original strand, 29822422 - 29822716
Alignment:
| Q |
20 |
agtgtgaccataactgagtcttgaggaacttaacataaaattggtacgatgattgtggatgaaacatggaggtggtgttgggagagtgaggaacaaagtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29822422 |
agtgtgaccataactgagtcttgaggaactgaacataaaattggtacgatgattgtggatgaaacatggaggtggtgttgggagagtgaggaacaaagtg |
29822521 |
T |
 |
| Q |
120 |
ttagagttagcagaagtagaaccaaacgttgccaatgccatggtttggttccaaagtgaatgtttcagtagtttgccatgtgcaagg-aaggtgaaactc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29822522 |
ttagagttagcagaagtagaaccaaacgttgctaatgccatggtttggttccagagtgaatgtttcagtagtttgccatgtgcaaggaaaggtgaaactc |
29822621 |
T |
 |
| Q |
219 |
aactaactgatcatcctgaggtcacatatctatctcc--nnnnnnnnnnggatgattatggtattgccacgctttaccccccaactacattccat |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
29822622 |
aactaactgatcatcctgaggtcacatatctatctccttttttttttttggatgattatggtattgccacgctttatcccccacctacattccat |
29822716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 444 - 509
Target Start/End: Original strand, 29822920 - 29822986
Alignment:
| Q |
444 |
gacctctacct-ttttaatgatatagaacttatgtggcacaattgagttcattaaaatcgacttcat |
509 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29822920 |
gacctctacctcttttaatgatatagaatttatgtggcacaattgagttcattaaaatcgacttcat |
29822986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University