View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_29 (Length: 308)
Name: NF11942_low_29
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 297
Target Start/End: Complemental strand, 39114693 - 39114413
Alignment:
| Q |
17 |
aaattgagggattgtgatccctcatttcatattggtaaccagctaatcgttgagagcatgcatgtatatgtggaggaggttgctaaacacttcgaaaaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39114693 |
aaattgagggattgtgatccctcatttcatattggtaaccagctaatcgttgagagcatgcatgtatatgtggaggaggttgctaaacatttcgaaaaat |
39114594 |
T |
|
| Q |
117 |
gggaccatatatttgctaccattaatccaaacataccatggcatggctatggctacttgtctagtccaatccaactgtacgtacgttctttgattttgag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39114593 |
gggaccatatatttgctaccattaatccaaacataccatggcatggctatggctacttgtctagtccaatccaactgtacgtacgttctttgattttgag |
39114494 |
T |
|
| Q |
217 |
agccatctattctcatatctgtcttggaaactcttgacacagtcgcatatactatatacaatttgttcttgtctcattcat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39114493 |
agccatctattctcatatctgtcttggaaactcttgacacagtcgcatatactatatacaatttgttcttgtctcattcat |
39114413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University