View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_32 (Length: 302)
Name: NF11942_low_32
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 133 - 289
Target Start/End: Original strand, 3987404 - 3987561
Alignment:
| Q |
133 |
ctatcactgtctattta-atttccaatcagcttacgtctttgggaattttgttacaggatagaggaaattattgatgaagatgtgcttcatgcacgggtt |
231 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3987404 |
ctatcactgtcaatttacatttccaatcagctcacgtctttgggaattttgttacagaatagaagaaattattgatgaagatgtgcttcatgcacgggtt |
3987503 |
T |
|
| Q |
232 |
ccttttgttgcctgcactcagcaatgctttgctgttaaggctggaattgacggtctct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3987504 |
ccttttgttgcctgcactcagcaatgctttgctgttaaggctggaattgacggtctct |
3987561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 5 - 120
Target Start/End: Original strand, 3987259 - 3987374
Alignment:
| Q |
5 |
aaaattctacgaattgattttaaaacgtggatattgagaaagctgtatactctaaagggtcacatcccactgcagtgtaaactatttagtgagtaatata |
104 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3987259 |
aaaattctacgaattgcttttaaatcttggatattgagaaagcttgatactctaaatggtcacatcccactgcaatgtaaactatttagtgagtaatata |
3987358 |
T |
|
| Q |
105 |
caatattttaattgat |
120 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3987359 |
caatattttaattgat |
3987374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University