View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_37 (Length: 264)
Name: NF11942_low_37
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 44 - 247
Target Start/End: Original strand, 43069243 - 43069447
Alignment:
| Q |
44 |
cttcaagaggagcttgtataataactagaagagggagtttccttggagggtctagatcttcctttgccgtacnnnnnnncttttgaaattcaatcttgta |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43069243 |
cttcaagaggagcttgtataataactagaagagggagtttccttggagggtctagatcttcctttgccgtacaaaaaaacttttgaaattcaatcttgta |
43069342 |
T |
 |
| Q |
144 |
agagctttttgtttcatttcatgcacaaaa-tattgaggaaaattttgaatcgctcatattttttgatgaaatgaaatcttcttaattattatattactt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43069343 |
agagctttttgtttcatttcatgcacaaaaatattgaggaaaattttgaatcgctcatattttttgatgaaatgaaatcttcttaattattatattactt |
43069442 |
T |
 |
| Q |
243 |
attct |
247 |
Q |
| |
|
||||| |
|
|
| T |
43069443 |
attct |
43069447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University