View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_45 (Length: 241)
Name: NF11942_low_45
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_45 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 53096332 - 53096555
Alignment:
| Q |
18 |
actctgggttggtgacattcataacgctcgggttctttggcaccatgnnnnnnnggaacttctaaactccggatgagctgactaatgtgaacatgagctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096332 |
actctgggttggtgacattcataacgctcgggttctttggcaccatgtttttttggaacttctaaactccggatgagctgactaatgtgaacatgagctg |
53096431 |
T |
 |
| Q |
118 |
cacaactcttccatgactttttatgaacaacaggttcggaaatctgcattgtcattaaacatttattattggaaacaactaataggcatttgagtggagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096432 |
cacaactcttccatgactttttatgaacaacaggttcggaaatctgcatcgtcattaaacatttattattggaaacaactaataggcatttgagtggaga |
53096531 |
T |
 |
| Q |
218 |
gcatcaactatgatgaaaaacttc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53096532 |
gcatcaactatgatgaaaaacttc |
53096555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 1369376 - 1369335
Alignment:
| Q |
18 |
actctgggttggtgacattcataacgctcgggttctttggca |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
1369376 |
actctggtttggtgacattcataacgctcagattctttggca |
1369335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University