View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_47 (Length: 238)
Name: NF11942_low_47
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 2121697 - 2121920
Alignment:
| Q |
13 |
tcaataagtgcaacacctcattcacactgatgtcataagtatatttatttaatattcacgtcatttcattagagtttcttttaatccagacaatgaattc |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2121697 |
tcaataagtgcaacacctcattcacaccgatgtcataagtatatt-atttaatattcacgtcatttcattagagtttcttttaacccagacaatggattc |
2121795 |
T |
|
| Q |
113 |
caacctagaacaccttttacataaattctccggcctcttcc--aacaactgacaacaataccatctgttgaagatataaaacactccattcgattttaca |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2121796 |
aaacctagaacaccttttacacaaattctccggcctcttccaaaacaactgacaacaataccatctgtcgaagatataaaacactccattcgattttaca |
2121895 |
T |
|
| Q |
211 |
tcacgcttaacccataagtgttcgt |
235 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
2121896 |
tcacgcctaacccataagtgttcgt |
2121920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University