View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_48 (Length: 235)
Name: NF11942_low_48
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 42021604 - 42021401
Alignment:
| Q |
19 |
cccacatcatatccactaccaaaccatccacaaaaattgtttgattgccacgaaaattccacttcaatctcttcaccttaaacacaatcttcttatccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021604 |
cccacatcatatccactaccaaaccatccacaaaaattgtttgattgccacgaaaattccacttcaatctcttcaccttaaacacaatcttcttatccat |
42021505 |
T |
|
| Q |
119 |
aaacaaacataacatgtgactctttgatgttgatccttcttcttctactccacactttatcaatatatcgtgtgaaattcctgtttcagaaaactttgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021504 |
aaacaaacataacatgtgactctttgatgttgatccttcttcttctactccacactttatcaatatatcgtgtgaaattcctgtttcagaaaactttgcc |
42021405 |
T |
|
| Q |
219 |
tttg |
222 |
Q |
| |
|
|||| |
|
|
| T |
42021404 |
tttg |
42021401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 115
Target Start/End: Complemental strand, 36056149 - 36056063
Alignment:
| Q |
29 |
atccactaccaaaccatccacaaaaattgtttgattgccacgaaaattccacttcaatctcttcaccttaaacacaatcttcttatc |
115 |
Q |
| |
|
|||||| | ||| ||||| ||||||||||||||||| || | ||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
36056149 |
atccaccaacaacccatcaacaaaaattgtttgattacccctaaaattccacttcaacctcttcacacaaattacaatcttcttatc |
36056063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 115
Target Start/End: Original strand, 20085449 - 20085525
Alignment:
| Q |
39 |
aaaccatccacaaaaattgtttgattgccacgaaaattccacttcaatctcttcaccttaaacacaatcttcttatc |
115 |
Q |
| |
|
|||||||| |||||||| |||||||| || | ||||||||| | |||||||||||| || |||| |||||||||| |
|
|
| T |
20085449 |
aaaccatcaacaaaaatggtttgattccctctaaaattccattgcaatctcttcacacgaatcacattcttcttatc |
20085525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University