View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_50 (Length: 234)
Name: NF11942_low_50
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 1825710 - 1825508
Alignment:
| Q |
18 |
agagtgcttgcaatgaactgataaatatataaataaattaggccaatgatattaaaatgacaacagctaggaaatttgggaaaaaa-cagtaagcaagca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1825710 |
agagtgcttgcaatgaactgataaatatataaataaattaggccaatgatattaaaatgacaacagctaggaaatttgggaaaaaaacagtaagcaagca |
1825611 |
T |
 |
| Q |
117 |
gattaaagaggataaaaatggatccatctttcaaacatttcaaagcattccctgttgttgtactctgttggagaatg-cctgctccctgtttaaccaaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1825610 |
gattaaagaggataaaaatggatccatctttcaaacatttcaaagcattccctgttgttgtactctgttggagaatgccctgctccctgtttaaccaaca |
1825511 |
T |
 |
| Q |
216 |
gac |
218 |
Q |
| |
|
||| |
|
|
| T |
1825510 |
gac |
1825508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 112 - 209
Target Start/End: Complemental strand, 1827843 - 1827747
Alignment:
| Q |
112 |
aagcagattaaagaggataaaaatggatccatctttcaaacatttcaaagcattccctgttgttgtactctgttggagaatgcc-tgctccctgtttaa |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||| |||||| || | |||||||| |||||||||||||| |
|
|
| T |
1827843 |
aagcagattaaagcggataaaaatggatccaactttcaaacattttgaagcattccctgttactgtactatg--gaagaatgccttgctccctgtttaa |
1827747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University