View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_51 (Length: 229)
Name: NF11942_low_51
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_51 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 3987005 - 3987228
Alignment:
| Q |
6 |
acatgcaactcttacatctaagatgatgaaagctttattacttgagttaaaattgttctgaagctgtaatacggggaaaaggccgactagaatattcaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3987005 |
acatgcaactcttacatctaagatgatgaaaactttattacttgagttaaaattgttctgaagctgtaatacggggaaaaggccgactagaatattcaga |
3987104 |
T |
 |
| Q |
106 |
ccaaaatattgctaaatcaacaatcaacaaatgattgtttgccatattacgaatttgctacaaagatatgtgatggagttccggattagtatgaaatgcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3987105 |
ccaaaatattgctaaatcaacaatcaacaaatgattgtttgccatattacgaatttgctacaaagatatgtgatggagttccggattagtatgaaatgcc |
3987204 |
T |
 |
| Q |
206 |
ccatcctaggaaattgtgtttaca |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3987205 |
ccatcctaggaaattgtgtttaca |
3987228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University