View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11942_low_54 (Length: 207)

Name: NF11942_low_54
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11942_low_54
NF11942_low_54
[»] chr8 (1 HSPs)
chr8 (33-167)||(7055728-7055862)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 33 - 167
Target Start/End: Complemental strand, 7055862 - 7055728
Alignment:
33 ttcttttcaaaaacaaattacccttttccaacaacctcaaacatagacaaatttccaagaagaccctttggcttcgatcaagagattggtgtcatggaga 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7055862 ttcttttcaaaaacaaattacccttttccaacaacctcaaacatagacaaatttccaggaagaccctttggcttcgatcaagagattggtgtcatggaga 7055763  T
133 taacttgagtgggcagtgtgcataggtgaataatg 167  Q
    |||||||||||||||||||||||||||||||||||    
7055762 taacttgagtgggcagtgtgcataggtgaataatg 7055728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University