View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11942_low_54 (Length: 207)
Name: NF11942_low_54
Description: NF11942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11942_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 33 - 167
Target Start/End: Complemental strand, 7055862 - 7055728
Alignment:
| Q |
33 |
ttcttttcaaaaacaaattacccttttccaacaacctcaaacatagacaaatttccaagaagaccctttggcttcgatcaagagattggtgtcatggaga |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7055862 |
ttcttttcaaaaacaaattacccttttccaacaacctcaaacatagacaaatttccaggaagaccctttggcttcgatcaagagattggtgtcatggaga |
7055763 |
T |
 |
| Q |
133 |
taacttgagtgggcagtgtgcataggtgaataatg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7055762 |
taacttgagtgggcagtgtgcataggtgaataatg |
7055728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University