View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11943_high_19 (Length: 239)
Name: NF11943_high_19
Description: NF11943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11943_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 37 - 223
Target Start/End: Complemental strand, 17365558 - 17365372
Alignment:
| Q |
37 |
ttaataatatactattaaatgatcaaaattcgtattgcatgtttgaaatcacgataaatttgaacaagttgcagtaacattatacttatactatgannnn |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17365558 |
ttaataatatactattaaatgatcaaaattcgtattgcatgtttgaaatcacaataaatttgaacaagttgcagtaacattatacttatactatgattat |
17365459 |
T |
 |
| Q |
137 |
nnnaaagggcttatacaaagattttgttgaagcttaaattatagtttttgtcaaatggtagatcaacgtaactgttaatcaaaatac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
17365458 |
tttaaagggcttatacaaagattttgttgaagcttaaattatagtttttgtcaaacggtagatcaatgcaactgttaatcaaaatac |
17365372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University