View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11943_high_20 (Length: 232)
Name: NF11943_high_20
Description: NF11943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11943_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 32644189 - 32644393
Alignment:
| Q |
15 |
agagcataaacatgcatataaatcctcactgcattatttacatagattacaaactcaacttgcccctacttgtatatatgctcaatacaagtacgtagta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32644189 |
agagcataaacatgcatataaatcctcactgcattatttacataggttacaaactcaacttgcccctacttgtatatatgctcaatacaagtacgtagta |
32644288 |
T |
 |
| Q |
115 |
attacaatgcatgacaaatttccgtaggctcaaaatctctaggcacattctgatttgattggagccaaatgctctacattcattgtacttcctacatgca |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32644289 |
attacaatgtatgacaaatttccgtaggctcaaaatctctaggcacattctgatttgattagagccaaatgctctacattcattgtacttcctacatgca |
32644388 |
T |
 |
| Q |
215 |
attgt |
219 |
Q |
| |
|
||||| |
|
|
| T |
32644389 |
attgt |
32644393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University