View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11944_high_6 (Length: 341)
Name: NF11944_high_6
Description: NF11944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11944_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 9e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 117 - 258
Target Start/End: Original strand, 22080442 - 22080583
Alignment:
| Q |
117 |
acaatatcatcaaaaacaaaatagaaatgcagttcaatagatctttgatatgtctttgattaaaatgacttctgaaacaattttagttcgaaaaattgat |
216 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
22080442 |
acaatatcatcaaatacaaaacagaaatgcagttcaatagatctttgatacgtctttcattaaaatgacttctcaaacaattttagttcgaaaaactgat |
22080541 |
T |
 |
| Q |
217 |
ttaatgcaagaaggaaaaccgatctattgaagtgttgttcac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22080542 |
ttaatgcaagaaggaaaaccgatctatttaagtgttgttcac |
22080583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 327
Target Start/End: Original strand, 22080648 - 22080682
Alignment:
| Q |
293 |
aaacacaaacattgcaagaaatgatctaaaaattg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22080648 |
aaacacaaacattgcaagaaatgatctaaaaattg |
22080682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University