View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11946_high_11 (Length: 240)
Name: NF11946_high_11
Description: NF11946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11946_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 14522241 - 14522459
Alignment:
| Q |
8 |
gagatgaagagttgccgaaaccaaagaaacccatggcaaagttgaaaccatctgagaataaaacatcaccttcttgatctcttacaacatcaccttgttt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14522241 |
gagaagaagagttgccgaaaccaaagaaacccatagcaaagttgaaaccatctgagaataaaacatcaccttcttgatctcttacaatatcaccttgttt |
14522340 |
T |
|
| Q |
108 |
gataccaccttgtgaaaaccctaaacagaaacacaacaacgtcaaagaaacaatgcatttgttgtatgttgagagcatcattgttaacaatagtattggt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14522341 |
gataccaccttgtgagaaccctaaacagaaacacaacaacgtaaaagaaacaatgcatttgttgtatgttgagagcatcatcgttaacaatagtattggt |
14522440 |
T |
|
| Q |
208 |
ttgaatgagagatcgagtt |
226 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
14522441 |
ttgaatgagagatcaagtt |
14522459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 111
Target Start/End: Original strand, 2693181 - 2693267
Alignment:
| Q |
25 |
aaaccaaagaaacccatggcaaagttgaaaccatctgagaataaaacatcaccttcttgatctcttacaacatcaccttgtttgata |
111 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||||||||| ||||| |||| ||||| | || ||||||||||||||| |
|
|
| T |
2693181 |
aaaccaaagaaacccattacgaagttgtgcccatctgagaataaaacttcaccatcttcgtctctgataaagtcaccttgtttgata |
2693267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University