View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11946_high_15 (Length: 238)
Name: NF11946_high_15
Description: NF11946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11946_high_15 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 3 - 116
Target Start/End: Complemental strand, 2046091 - 2045977
Alignment:
| Q |
3 |
gcgtacgtatgagtgatcgtatttctgctcctttattgcgctagcgttttaaaattatgaacgatagagagaagatcaacttgaagcttatttggggatt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
2046091 |
gcgtacgtatgagtgatcgtatttctgctcctttattgcgctaacgttttaaaattatgaacgatagagagaagatcaactcgaagcttatttgaggatt |
2045992 |
T |
|
| Q |
103 |
gaat-atgtcccaac |
116 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
2045991 |
gaatcatgtcccaac |
2045977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 46899 - 46939
Alignment:
| Q |
24 |
tttctgctcctttattgcgctagcgttttaaaattatgaac |
64 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
46899 |
tttctgctcttttattgcgctaacgttttaaaattatgaac |
46939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 65
Target Start/End: Original strand, 15044116 - 15044157
Alignment:
| Q |
24 |
tttctgctcctttattgcgctagcgttttaaaattatgaacg |
65 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
15044116 |
tttctgctcttttattgcgctaacgtttgaaaattatgaacg |
15044157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University