View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11946_low_10 (Length: 250)
Name: NF11946_low_10
Description: NF11946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11946_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 45037641 - 45037387
Alignment:
| Q |
12 |
gagatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccctgtgtatctccaaggctttga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037641 |
gagatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccctgtgtatctccaaggctttga |
45037542 |
T |
 |
| Q |
112 |
tccctgaacaaaatcgaaaaatcaagtca-tgtaa---------------aaatttattcacacaatcaataaatcaaaatatgcattccattacttacc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45037541 |
tccctgaacaaaatcgaaaaatcaagtcactgtaaaaatttatgcacttcaaatttattcacacaatcaataaatcaaaatatgcattgcattacttacc |
45037442 |
T |
 |
| Q |
196 |
gctgcacaatagtgaacaaccttgactttatgaagctcaacattttcaggatgac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45037441 |
gctgcacaatagtgaacaaccttgactttatgaagctcaacattttcagggtgac |
45037387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 250
Target Start/End: Complemental strand, 20395365 - 20395304
Alignment:
| Q |
189 |
acttaccgctgcacaatagtgaacaaccttgactttatgaagctcaacattttcaggatgac |
250 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||| | ||| |||||||| |||||||||| |
|
|
| T |
20395365 |
acttaccgctgcacagtaatgaacaactttgactttctcaagttcaacattctcaggatgac |
20395304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University