View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11946_low_8 (Length: 312)
Name: NF11946_low_8
Description: NF11946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11946_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 298
Target Start/End: Original strand, 493849 - 494131
Alignment:
| Q |
16 |
ctctctaccgtcattctcaacaatttgacatcgactttcaacacacggttgagattttttgtgcttattagaagtccattatcatcgggacaagctagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493849 |
ctctctaccgtcattctcaacaatttgacatcgactttcaacacacggttgagattttttgtgcttattagaagtccattatcatcgggacaagctagtt |
493948 |
T |
 |
| Q |
116 |
ttggtatgctgtgagagaagcgcgttgcaactttcacttttctgctgttttttgaagctaacgcgactattgatataagctccgtctcagtggttgggta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
493949 |
ttggtatgctgtgagagaagcgcgttgcaactttcacttttctgttgttttttgaagctaacgcgactattgatataagctccgcctcagtggttgggta |
494048 |
T |
 |
| Q |
216 |
cataacctcgctagctctgcaaatgcttcgatcgggaaacacgccatttgaattggtgatggtgcagtttgtattatttgatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
494049 |
cataacctcgctagctctgcaaatgcttcgatcggggaacacgccatttgaattggtgatggtgcagtttgtattatttgatg |
494131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 96 - 298
Target Start/End: Complemental strand, 49013627 - 49013425
Alignment:
| Q |
96 |
atcatcgggacaagctagttttggtatgctgtgagagaagcgcgttgcaactttcacttttctgctgttttttgaagctaacgcgactattgatataagc |
195 |
Q |
| |
|
|||||| ||||||| ||| ||||| |||||||| ||||||||||| |||||||||| ||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
49013627 |
atcatcaggacaagttagctttggaatgctgtgggagaagcgcgtcgcaactttcatttttctgttgttttctgaagctaacgcgactattgatataagc |
49013528 |
T |
 |
| Q |
196 |
tccgtctcagtggttgggtacataacctcgctagctctgcaaatgcttcgatcgggaaacacgccatttgaattggtgatggtgcagtttgtattatttg |
295 |
Q |
| |
|
|| ||| | |||||| |||| ||||||||||||| ||||||||||| | || || ||| ||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
49013527 |
tctacctctgaggttggatacacaacctcgctagctttgcaaatgctttggtcagggaacgcgccattggaattcgtgatggtgcagtttgtgttatttg |
49013428 |
T |
 |
| Q |
296 |
atg |
298 |
Q |
| |
|
||| |
|
|
| T |
49013427 |
atg |
49013425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University