View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11947_low_12 (Length: 352)
Name: NF11947_low_12
Description: NF11947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11947_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 12 - 343
Target Start/End: Complemental strand, 54472899 - 54472568
Alignment:
| Q |
12 |
aagcagagaacacatatgtttggtaacaaagttataccaattgtgcagttcctttctatcatcgtcatcttaaaagattaggatttaaattgtacaactt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54472899 |
aagcagagaacacatatgtttggtaacaaagttataccaattgtgcagttcctttctatcatcgtcatcttaaaagaataggatttaaattgtacaactt |
54472800 |
T |
|
| Q |
112 |
gtatttatatattacggttcaggcttcaaacccgcgcccctaatcaccccacgcaacttaccttcgtgtaactgtgttggttcaaaaaggcatgtcactc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472799 |
gtatttatatattacggttcaggcttcaaacccgcgtccctaatcacccctcgcaacttaccttcgtgtaactgtgttggttcaaaaaggcatgtcactc |
54472700 |
T |
|
| Q |
212 |
tcgcttcgcttaattgactctcccacttattagcattataagacatactcaacatatacaactagccttttaacaaatgatttgaacaaattagatcctt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472699 |
tcgcttcgcttaattgactctcccacttattagcattataacacatactcaacatatacaactagccttttaacaaatgatttgaacaaattagatcctt |
54472600 |
T |
|
| Q |
312 |
tatgaccagggattgataaattcaaagataac |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54472599 |
tatgaccagggattgataaattcaaagataac |
54472568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University