View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11949_high_4 (Length: 266)
Name: NF11949_high_4
Description: NF11949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11949_high_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 10558833 - 10558582
Alignment:
| Q |
16 |
catatatgtcttaatttgataagattttcatttagtattgggatggtgtacactattactgcacgcaggcagccacatctggtcggacagtccaaatttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10558833 |
catatatgtcttaatttgataagattttcatttagtattgggattgtgtacactattactgcacgcaggcaaccacatctggtcggacagtccaaatttc |
10558734 |
T |
 |
| Q |
116 |
aaagtaaattttannnnnnnnaaatctaaaataccgagcttgaaatctagaccacttgactttgaggtggcaggttgcgtgcagttagagaacttctggt |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10558733 |
aaagtaaattttatttttttaaaatctaaaataccgagcttgaaatctagaccacttgactttgaggtggcaggttgcgtgcagttagagaacttctggt |
10558634 |
T |
 |
| Q |
216 |
atgcaccgaaagtaaaagag-tttatacattcatttatttatatttcaccac |
266 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10558633 |
atgcaccgaaagtaaaagagttttatacattcatttatttatatttcaccac |
10558582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University