View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_18 (Length: 315)
Name: NF1194_low_18
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_18 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 113 - 315
Target Start/End: Complemental strand, 27400200 - 27399997
Alignment:
| Q |
113 |
tcacaagaagcaactttatccaaatatagaacatcttcttttataggttgtcttaaacaacctcaatttggttcaacatattttcaggtaatgccaacag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27400200 |
tcacaagaagcaactttatccaaatatagaacatcttcttttataggttgtcttaaacaacctcaatttggttcaacatgttttcaggtaatgccaacag |
27400101 |
T |
|
| Q |
213 |
aaaa-taaaaatggcaattcacaacataatttacattttcacataacactacatatatggtactatttaagtgttgaatgttcaaacataagcattttca |
311 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27400100 |
aaaattaaaaatggcaattcacaacataatttacattttcacataacactacatatatggtactatttaagtgttgaatgttcaaacataagcattttca |
27400001 |
T |
|
| Q |
312 |
agtt |
315 |
Q |
| |
|
|||| |
|
|
| T |
27400000 |
agtt |
27399997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 118
Target Start/End: Complemental strand, 27400302 - 27400260
Alignment:
| Q |
76 |
cataggtattgagactctagctagacttaggtattgttcacaa |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27400302 |
cataggtattgatactctagctagacttaggtattgttcacaa |
27400260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University