View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_19 (Length: 307)
Name: NF1194_low_19
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 229
Target Start/End: Complemental strand, 16015678 - 16015451
Alignment:
| Q |
2 |
aaagagggggtacctgctaatcaagatgatgaaggtttaacaaagaaaaaataatgtctaaggagatattagtgaagatgcacatcatcaaatgattgac |
101 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16015678 |
aaagaaggggtacctgctcatcaagattatgaaggtttaacaaagaaaaaataatgtctaagaagatattagtgaagatgcacatcatcaaatgattgac |
16015579 |
T |
|
| Q |
102 |
ctgataaatctacattagaatgagagttgtctcttgatgaaccaaattggaagtcacattatgttatttcttgatgaactagagttagtgttagattgac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16015578 |
ctgataaatctacattagaatgagagttgtctcttgatgaaccaaattggaagtcacattatgttatttcttgatgaactagagttagtgttagattgac |
16015479 |
T |
|
| Q |
202 |
acaaactacataacaacgctttccctat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16015478 |
acaaactacataacaacgctttccctat |
16015451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University