View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_20 (Length: 302)
Name: NF1194_low_20
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 32 - 275
Target Start/End: Original strand, 33051745 - 33051989
Alignment:
| Q |
32 |
gtggctcaaatttcctaaatcattgattgtcaaattaagtctagacccttcacccctttttgtttcgtcctggctagtctagttaatt-accagaaacaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33051745 |
gtggctcaaatttcctaaatcattgattgtcaaattaagtctagaaccttcacccctttttgtttcgtcctggctagtctagttaatttaccagaaacaa |
33051844 |
T |
|
| Q |
131 |
agtttctaaatctcttgggggtaaccataaaaactccaagttatttgcacactttataccaaatattattccaaacttcgcacaaagaataaatgttgtt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33051845 |
agtttctaaatctcttgggggtaaccataaaaactccaagttatttgcacactttatacaaaatattaatccaaacttcgcacaaagaataaatgttgtt |
33051944 |
T |
|
| Q |
231 |
ccaattcttgattccaagagcacaaacacaagtagtagcattcat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33051945 |
ccaattcttgattccaagagcacaaacacaagtagtagcattcat |
33051989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University