View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_22 (Length: 262)
Name: NF1194_low_22
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 27774435 - 27774687
Alignment:
| Q |
1 |
tcatcatcgtcatcttgtacaagctgtctttgaactgcttgataaatagtcaactgtctgttcaattgtttcccaccagcagtgaatattaactttggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774435 |
tcatcatcgtcatcttgtacaagctgtctttgaactgcttgataaatagtcaactgtctgttcaattgtttcccaccagcagtgaatattaactttggag |
27774534 |
T |
|
| Q |
101 |
gatcattagaactaccaaacaagggacgcccgtgccggtctcttccccctctgattcctctgctattggcagatcccagtccagccatagcagcagcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27774535 |
gatcattagaactaccaaacaagggacgcccgtgccggtctcttccccctctgattcctctgctattggcagatccaagtccagccatagcagcagcagc |
27774634 |
T |
|
| Q |
201 |
aaatgacattgcacctcgtgagctagaagaatagccactcctaaaatctgtgg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774635 |
aaatgacattgcacctcgtgagctagaagaatagccactcctaaaatctgtgg |
27774687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University