View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_25 (Length: 251)
Name: NF1194_low_25
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 49 - 251
Target Start/End: Original strand, 27730965 - 27731171
Alignment:
| Q |
49 |
atttgcattgaaatatatgatgattacaagaatt---caagacagtaataagttttgattagtttggcaaattaaacaatgatatttgttagtccaaatg |
145 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | || |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27730965 |
atttgcattgaaatatatgattattacaagaattagtctagccagtaataagttttaattagtttgtcaaattaaacaatgatatttgttagtccaaatg |
27731064 |
T |
 |
| Q |
146 |
ttcagttgcttctgttcttataggaataacacta-aagtaaattgcacgtgcatatcaaagtcacacacacatgcttattgttctttcttgaatgagtaa |
244 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27731065 |
ttcagttgcttctattcttacaggaataacactataagtaaattgcacatgcatatcaaagtcacacacacatgcttattgttctttcttgaatgagtaa |
27731164 |
T |
 |
| Q |
245 |
tcagaat |
251 |
Q |
| |
|
||||||| |
|
|
| T |
27731165 |
tcagaat |
27731171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University