View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_28 (Length: 251)
Name: NF1194_low_28
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 5 - 251
Target Start/End: Original strand, 35866267 - 35866513
Alignment:
| Q |
5 |
gactgatatgaatttccaatgtcttcctcgatggaacctcgttctttatttggtatagttatttcgtttctcctatcaaaaagataacacacaagtcaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35866267 |
gactgatatgaatttccaatgtcttcctcgatggaacctcgttctttatttggtatagttatttcgtttctcctatcaaaaagataacacacaagtcaaa |
35866366 |
T |
|
| Q |
105 |
ttgctttaaaagtgactaatattgcaataagttactattctgcttaagttatttaactatccaaagtttcaaacaagctcttactgtgttcaacatgtgt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35866367 |
ttgctttaaaagtgactaatattgcaataagttactattctgcttaacttatttaactatccaaagtttcaaacaagctcttactgtgttcaacatgtgt |
35866466 |
T |
|
| Q |
205 |
tttttagtgcctaatgacttttctatagtatagaaagtggaacttac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35866467 |
tttttagtgcctaatgacttttctatagtatagaaagtggaacttac |
35866513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University