View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1194_low_7 (Length: 403)
Name: NF1194_low_7
Description: NF1194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1194_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 16 - 309
Target Start/End: Complemental strand, 8448974 - 8448681
Alignment:
| Q |
16 |
ataattcagtgaaaattaattagatttgaggcatttaaaatgcaggatttgaggcctgaaattccaagggatactcatccaaagttagtcgagttacttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448974 |
ataattcagtgaaaattaattagatttgaggcatttaaaatgcaggatttgaggcctgaaattccaagggatactcatccaaagttagtcgagttacttc |
8448875 |
T |
|
| Q |
116 |
accgctgttggcacaaagatccctccttaaggcccgacttcgcagaaattattaagtttctacatcacattaacaacatggtatggggaggaatatagct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448874 |
accgctgttggcacaaagatccctccttaaggcccgacttctcagaaattattaagtttctacatcacattaacaacatggtatggggaggaatatagct |
8448775 |
T |
|
| Q |
216 |
agatagacttcttgttaccgttgccnnnnnnnaacttctaaaatgctttgttttcccccttatgtacttgtacagattgcagggaagaaaaaga |
309 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448774 |
agatagacttcttgttaccgttgcctttttttaacttctaaaatgctttgttttcgcccttatgtacttgtacagattgcagggaagaaaaaga |
8448681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University