View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11950_high_16 (Length: 302)
Name: NF11950_high_16
Description: NF11950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11950_high_16 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 121 - 302
Target Start/End: Complemental strand, 410530 - 410349
Alignment:
| Q |
121 |
ttgacctgagcaacaattccactatcaagagctttgactaaagcatcttcatcaataacaccacctctagcaacattgatgattctcacacccttcttca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
410530 |
ttgacctgagcaacaattccactatcaagagctttgactaaagcatcttcatcaataacaccacctctagcaacattgatgattctcacaccattcttca |
410431 |
T |
|
| Q |
221 |
tcttagcaaaagtgttttcattgaagaccttgttagtagttggagtgagaggcatgtgaagtgagatgaaatcagcggttgt |
302 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410430 |
tcttagcaaaagtgttgtcattgaagactttgttagtagttggagtgagaggcatgtgaagtgagatgaaatcagcggttgt |
410349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 16 - 97
Target Start/End: Complemental strand, 410681 - 410600
Alignment:
| Q |
16 |
acatcaagagctgcctgctccaagttcaaacaaaatagaaatgtcatttgaatggttaacagataaatcattaatttcaaat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
410681 |
acatcaagagctgcctgctccaagttcaaacaaaatagaaatgtcatttgaatggttaacagataactaattaatttcaaat |
410600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University