View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11950_low_12 (Length: 361)
Name: NF11950_low_12
Description: NF11950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11950_low_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 180 - 361
Target Start/End: Complemental strand, 410530 - 410349
Alignment:
| Q |
180 |
ttgacctgagcaacaattccactatcaagagctttgactaaagcatcttcatcaataacaccacctctagcaacattgatgattctcacacccttcttca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
410530 |
ttgacctgagcaacaattccactatcaagagctttgactaaagcatcttcatcaataacaccacctctagcaacattgatgattctcacaccattcttca |
410431 |
T |
 |
| Q |
280 |
tcttagcaaaagtgttttcattgaagaccttgttagtagttggagtgagaggcatgtgaagtgagatgaaatcagcggttgt |
361 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410430 |
tcttagcaaaagtgttgtcattgaagactttgttagtagttggagtgagaggcatgtgaagtgagatgaaatcagcggttgt |
410349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 410738 - 410600
Alignment:
| Q |
18 |
atcacattctcatgttgcactaacttactgtctttggctggaggctcctcagtgaacacatcaagagctgcctgctccaagttcaaacaaaatagaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410738 |
atcacattctcatgttgcactaacttactgtctttggctggaggctcctcagtgaacacatcaagagctgcctgctccaagttcaaacaaaatagaaatg |
410639 |
T |
 |
| Q |
118 |
tcatttgaatggttaacagataaatcattaatttcaaat |
156 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
410638 |
tcatttgaatggttaacagataactaattaatttcaaat |
410600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University