View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11950_low_20 (Length: 254)
Name: NF11950_low_20
Description: NF11950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11950_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 5174141 - 5173912
Alignment:
| Q |
13 |
atgataatataacataattagttgtccaaaacactacacaacatatattaatttcataacaatacagcttgtctcctttgtaaaacctttaactttgtgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174141 |
atgataatataacataattagttgtccaaaacactacataacatatattaatttcataacaatacagcttgtctcctttgtaaaacctttaactttgtgt |
5174042 |
T |
 |
| Q |
113 |
cgatatcaacaatacggcctgcaattgtgacattctaatatatatactcacaaaaataaattatgtgcatacactccaaaaacacttgaatgaaatgact |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174041 |
cgatatcaacaatacggcctgcaattgtgacattctaatatatatactcacaaaattaaattatgtgcatacactccaaaaacacttgaatgaaatgact |
5173942 |
T |
 |
| Q |
213 |
cgggtctcttacaacataacataggtccta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5173941 |
cgggtctcttacaacataacataggtccta |
5173912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University