View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11950_low_5 (Length: 549)
Name: NF11950_low_5
Description: NF11950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11950_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 410356 - 410133
Alignment:
| Q |
1 |
gcggttgtgattgcttgatcaaatgagactaattccacaccaacagcacgtgctctatcagctggagcataagggtcatgagcaatcacattcattccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410356 |
gcggttgtgattgcttgatcaaatgaaactaattccacaccaacagcacgtgctctatcagctggagcataagggtcatgagcaatcacattcattccta |
410257 |
T |
|
| Q |
101 |
atccttttgcacgccttgcaacttcagatccaacttttccaaatcccattattgctaatgttttcccaaccatagatactcccacatacttgcttcttag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
410256 |
atccttttgcacgccttgcaacttcagatccaacttttccaaaccccattattgctaatgttttcccaaccatagatactccaacatacttgcttctcag |
410157 |
T |
|
| Q |
201 |
ccattttcctgcaaaaattatcaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
410156 |
ccattttcctgcaaaaattatcaa |
410133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 197
Target Start/End: Complemental strand, 48785548 - 48785408
Alignment:
| Q |
57 |
atcagctggagcataagggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaatcccattattgct |
156 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| || ||||| || | || || |||||||| ||||| |||| |||||| || ||||||||||||| || |
|
|
| T |
48785548 |
atcagcaggagcataaggatcatgagcaataaccttcataccaagccccttagcacgcctagcaacctcagttccaaccttcccaaatcccattacagca |
48785449 |
T |
|
| Q |
157 |
aatgttttcccaaccatagatactcccacatacttgcttct |
197 |
Q |
| |
|
| ||| |||||||| | || ||||| |||||||| ||||| |
|
|
| T |
48785448 |
agtgtcttcccaactagggaaactccaacatacttacttct |
48785408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University