View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11952_low_10 (Length: 482)
Name: NF11952_low_10
Description: NF11952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11952_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 27 - 403
Target Start/End: Complemental strand, 6775575 - 6775201
Alignment:
| Q |
27 |
aataatgtgttgattgttaattgttcctccctccgagttgaacacgactctcagaaacaactagtccagtggttgtgttgttttcagttgactttaaggt |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6775575 |
aataatgtgttgattgttagttgttcctccctccgagttgaacacgactctcagaaacaacaagtccagtggttgt--tgttttcagttgactttaaggt |
6775478 |
T |
|
| Q |
127 |
ttccgatcgaaatttgataaacatcaatggcgggtcgcagagatgcattgctgaccagagataagaatcattcaatcaccgcttctcggatcgccgttgc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6775477 |
ttccgatcgaaatttgataaacatcaatggcgggtcgcagagatgcattgctgaccagagataagaatcattcaatcaccgcttctcggatcgccgttgc |
6775378 |
T |
|
| Q |
227 |
cgttttcatcggtgttcttcttggttgcatcttcgctttcttctctcctcatggtttcgtcatttccaccacctcaactcagaccattctcagccacaag |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6775377 |
cgttttcatcggtgttcttcttggttgcatcttcgctttcttctctcctcatggtttcttcatttccaccacctcaactcagaccattctcagccacaag |
6775278 |
T |
|
| Q |
327 |
gttgctttctatatctgcttcaatttagtaatataatctatttttagcttctttctactttaagactttgtttgaaa |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6775277 |
gttgctttctatatctgcttcaatttagtaatataatctatttttagcttctttctactttaagactttgtttgaaa |
6775201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University