View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11952_low_28 (Length: 219)
Name: NF11952_low_28
Description: NF11952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11952_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 63 - 207
Target Start/End: Complemental strand, 1416360 - 1416214
Alignment:
| Q |
63 |
gaaagtaaacatcttgatcattcctttcttcagttttagctgaagagatnnnnnnnnnnnnnnnnnnn--agttgtgaggaataattatttagttttgtt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1416360 |
gaaagtaaacatcttgatcattcctttcttcagttttagctgaagagattctctctctctatctctctctagttgtgaggaatatttatttagttttgtt |
1416261 |
T |
 |
| Q |
161 |
gactaccgacacccttatttttcccaaaaaagacattctaccttcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416260 |
gactaccgacacccttatttttcccaaaaaagacattctaccttcat |
1416214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 1416418 - 1416381
Alignment:
| Q |
1 |
cagtctgtaccatcaatcttcactatagctgaagagat |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416418 |
cagtctgtaccatcaatcttcactatagctgaagagat |
1416381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University