View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11952_low_29 (Length: 218)
Name: NF11952_low_29
Description: NF11952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11952_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 21 - 202
Target Start/End: Original strand, 30803835 - 30804014
Alignment:
| Q |
21 |
cttgtagcaagcattagcgaaggaaaaaagttgaaggacaaaatttacttacaatatattatagnnnnnnnnnnnnnnnattgttctccgattaaaattt |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30803835 |
cttgtagccagcattagcgaaggaaaaaagttgaaggacaaaatttacttacaatatattatagttttttttttttt--actgttctccgattaaaattt |
30803932 |
T |
 |
| Q |
121 |
ataacgaacatatttgaatgtcgattcaatttcataataatatcccttttgtttttgtttgacctcacgagcgtcgtctgtg |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803933 |
gtaacgaacatatttgaacgtcgattcaatttcataataatatcccttttgtttttgtttgacctcacgagcgtcgtctgtg |
30804014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University