View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11952_low_8 (Length: 502)
Name: NF11952_low_8
Description: NF11952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11952_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 439; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 20 - 486
Target Start/End: Original strand, 16579314 - 16579780
Alignment:
| Q |
20 |
gacagaaagcaaagagaagagaggatgagtatgagccgagaggatcgagcaagaacgccttttattgattatttgagaccgattatagctgatggtgaca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
16579314 |
gacagaaagcaaagagaagagaggatgagtatgagccgagaagatcgagcaagaacgccttttattgattatttgagaccgataatagctgatggcgaca |
16579413 |
T |
|
| Q |
120 |
ctggattcggtggcacaacagctactgttaagctttgtaagctttttgtcgaacgcggtgctgctggcattcacattgaggatcaatcttctgtgactaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16579414 |
ctggattcggtggcacaacagctactgttaagctttgtaagctttttgtcgaacgtggtgctgctgggattcacatcgaggatcaatcttctgtgactaa |
16579513 |
T |
|
| Q |
220 |
gaaatgcggtcacatggcagggaaagttttggttgcggttagcgaacatattaataggcttgttgctgcaaggcttcaatttgatgtgatgggagttgaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16579514 |
gaaatgcggtcacatggcagggaaagttttggttgcggttagcgaacatattaataggcttgttgctgcaaggcttcaatttgatgtcatgggagttgaa |
16579613 |
T |
|
| Q |
320 |
actgttttggttgctagaactgatgctgttgctgctaatcttattcaatcgaacattgatacaagggatcatcagtttattttgggcgtgacgaatccga |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16579614 |
actgttttggttgctagaactgatgctgttgctgctaatcttattcaatcgaacattgatacaagggatcatcagtttattttgggcgtgacgaatccga |
16579713 |
T |
|
| Q |
420 |
gtctgaagggaaagagtttggcaacagttatggcacaaggatttgcttctggaaagagtggagctga |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16579714 |
gtctgaagggaaagagtttggcaacagttatggcacaaggatttgcttctggaaagagtggagctga |
16579780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University