View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11953_high_14 (Length: 283)
Name: NF11953_high_14
Description: NF11953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11953_high_14 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 192 - 283
Target Start/End: Complemental strand, 30831587 - 30831496
Alignment:
| Q |
192 |
aggatacacgttagcataaccctaaatcgccaaaattcaccatagacgaaagtagttttatttataattgagaccacaaagagagtgtgtgt |
283 |
Q |
| |
|
|||| |||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831587 |
aggacacacgttagcataattctaaatcgcgaaaattcaccatagacaaaagtagttttatttataattgagaccacaaagagagtgtgtgt |
30831496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 30831755 - 30831716
Alignment:
| Q |
34 |
tttatggaaaatgctaaacaacgtctttagaacattggtt |
73 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30831755 |
tttatggaaaatgttaaacaacgtctttagaacattggtt |
30831716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University