View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11953_low_14 (Length: 283)

Name: NF11953_low_14
Description: NF11953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11953_low_14
NF11953_low_14
[»] chr2 (2 HSPs)
chr2 (192-283)||(30831496-30831587)
chr2 (34-73)||(30831716-30831755)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 192 - 283
Target Start/End: Complemental strand, 30831587 - 30831496
Alignment:
192 aggatacacgttagcataaccctaaatcgccaaaattcaccatagacgaaagtagttttatttataattgagaccacaaagagagtgtgtgt 283  Q
    |||| ||||||||||||||  ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
30831587 aggacacacgttagcataattctaaatcgcgaaaattcaccatagacaaaagtagttttatttataattgagaccacaaagagagtgtgtgt 30831496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 30831755 - 30831716
Alignment:
34 tttatggaaaatgctaaacaacgtctttagaacattggtt 73  Q
    ||||||||||||| ||||||||||||||||||||||||||    
30831755 tttatggaaaatgttaaacaacgtctttagaacattggtt 30831716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University