View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11953_low_15 (Length: 280)
Name: NF11953_low_15
Description: NF11953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11953_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 42 - 268
Target Start/End: Original strand, 29651274 - 29651495
Alignment:
| Q |
42 |
aacacaattcaatcatctccatcatgtgttttcttcaacttcactcttcaatctagtagtcatctttaattcagtaaaaaatgttgacttgaccgttgaa |
141 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29651274 |
aacacaattcaatcatctcc------tgttttcttcaacttcactcttcaatccagtaatcatttttaattcagtaaaaattgttgacttgaccgttgaa |
29651367 |
T |
 |
| Q |
142 |
aatgatgagataacatagtgaatagtgatgtataagagggctaaaatgaaagataatcttcattatttttcaagttctctctccctctc-cccagtaatt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29651368 |
aatgatgagataacatagtgaatagtgatgtataagagggctaaaatgaaagataatcttcattatttttcaagttctctctccctctctcccagtaatt |
29651467 |
T |
 |
| Q |
241 |
ttttgtcggttgataattttctttgttc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29651468 |
ttttgtcggttgataattttctttgttc |
29651495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University