View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11954_high_20 (Length: 222)

Name: NF11954_high_20
Description: NF11954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11954_high_20
NF11954_high_20
[»] chr8 (2 HSPs)
chr8 (54-212)||(43082602-43082760)
chr8 (1-33)||(43082759-43082791)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 54 - 212
Target Start/End: Complemental strand, 43082760 - 43082602
Alignment:
54 attagagttgctgcctgtctgtttgcgacagatcgaggtatagccatttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43082760 attagagttgctgcctgtctgtttgcgacagatcgaggtatagccttttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa 43082661  T
154 ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgct 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43082660 ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgct 43082602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 43082791 - 43082759
Alignment:
1 tttgaactcatcacattcgatggccaagaacat 33  Q
    |||||||||||||||||||||||||||||||||    
43082791 tttgaactcatcacattcgatggccaagaacat 43082759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University