View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11954_high_20 (Length: 222)
Name: NF11954_high_20
Description: NF11954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11954_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 54 - 212
Target Start/End: Complemental strand, 43082760 - 43082602
Alignment:
| Q |
54 |
attagagttgctgcctgtctgtttgcgacagatcgaggtatagccatttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082760 |
attagagttgctgcctgtctgtttgcgacagatcgaggtatagccttttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa |
43082661 |
T |
|
| Q |
154 |
ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082660 |
ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgct |
43082602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 43082791 - 43082759
Alignment:
| Q |
1 |
tttgaactcatcacattcgatggccaagaacat |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43082791 |
tttgaactcatcacattcgatggccaagaacat |
43082759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University