View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11955_high_22 (Length: 203)
Name: NF11955_high_22
Description: NF11955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11955_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 35382682 - 35382578
Alignment:
| Q |
1 |
aggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaataatgggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35382682 |
aggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaataatgggaa |
35382583 |
T |
 |
| Q |
101 |
tggat |
105 |
Q |
| |
|
||||| |
|
|
| T |
35382582 |
tggat |
35382578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 35387740 - 35387657
Alignment:
| Q |
8 |
taaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaata |
93 |
Q |
| |
|
|||||||||||||||| | | || |||||||||||| |||| |||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35387740 |
taaggcatgagccacaag-tatctgtcaaatagtacaaccgaattgtgcagcccaatattaattttg-aaaataagggcacaaata |
35387657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 184
Target Start/End: Complemental strand, 35382579 - 35382550
Alignment:
| Q |
155 |
atcctcttagtttatgacttatgtgctcaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35382579 |
atcctcttagtttatgacttatgtgctcaa |
35382550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University