View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11955_high_22 (Length: 203)

Name: NF11955_high_22
Description: NF11955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11955_high_22
NF11955_high_22
[»] chr8 (3 HSPs)
chr8 (1-105)||(35382578-35382682)
chr8 (8-93)||(35387657-35387740)
chr8 (155-184)||(35382550-35382579)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 35382682 - 35382578
Alignment:
1 aggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaataatgggaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35382682 aggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaataatgggaa 35382583  T
101 tggat 105  Q
    |||||    
35382582 tggat 35382578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 35387740 - 35387657
Alignment:
8 taaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaata 93  Q
    |||||||||||||||| | | || |||||||||||| |||| |||||||| ||||| |||||||||| ||||||||||||||||||    
35387740 taaggcatgagccacaag-tatctgtcaaatagtacaaccgaattgtgcagcccaatattaattttg-aaaataagggcacaaata 35387657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 184
Target Start/End: Complemental strand, 35382579 - 35382550
Alignment:
155 atcctcttagtttatgacttatgtgctcaa 184  Q
    ||||||||||||||||||||||||||||||    
35382579 atcctcttagtttatgacttatgtgctcaa 35382550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University