View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11955_low_19 (Length: 229)

Name: NF11955_low_19
Description: NF11955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11955_low_19
NF11955_low_19
[»] chr2 (1 HSPs)
chr2 (7-61)||(37397503-37397557)


Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 37397557 - 37397503
Alignment:
7 caaccaacaacaaaagttctgctatttacagatgcagcatcaaggataatggcaa 61  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
37397557 caaccaacaacaaaagttctgctatttacagatgcagtatcaaggataatggcaa 37397503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University