View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11955_low_19 (Length: 229)
Name: NF11955_low_19
Description: NF11955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11955_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 37397557 - 37397503
Alignment:
| Q |
7 |
caaccaacaacaaaagttctgctatttacagatgcagcatcaaggataatggcaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37397557 |
caaccaacaacaaaagttctgctatttacagatgcagtatcaaggataatggcaa |
37397503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University