View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11955_low_8 (Length: 502)
Name: NF11955_low_8
Description: NF11955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11955_low_8 |
 | |
|
| [»] scaffold0245 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0245 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0245
Description:
Target: scaffold0245; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 219 - 273
Target Start/End: Original strand, 18894 - 18948
Alignment:
| Q |
219 |
ggtgattgtcaacgaggggagtggaagtttttcaggtaagccatacttccaaggt |
273 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18894 |
ggtgattgtccacgtgaggagtggaagtttttcaggtaagccatacttccaaggt |
18948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 219 - 273
Target Start/End: Original strand, 1292487 - 1292541
Alignment:
| Q |
219 |
ggtgattgtcaacgaggggagtggaagtttttcaggtaagccatacttccaaggt |
273 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1292487 |
ggtgattgtccacgtgaggagtggaagtttttcaggtaagccatacttccaaggt |
1292541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University