View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11956_high_14 (Length: 249)
Name: NF11956_high_14
Description: NF11956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11956_high_14 |
 |  |
|
| [»] scaffold0305 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 36810621 - 36810381
Alignment:
| Q |
1 |
tttttgatccgtgcactgtcattacaattggtgtattcgataactgtcacttgcaccatggtggtgataagcctggaggacaaagagattctaaaatcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36810621 |
tttttgatccgtgcactgtcattacaattggtgtattcgataactgtcacttgcaccatggtggtgataagcctggaggacaaagagattctaaaatcgg |
36810522 |
T |
 |
| Q |
101 |
caaggtaagaatccgtctttccacactcgagactgatcgagtctacacacattcctatccacttctagttcttcatccaactggggtgaagaaaatggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36810521 |
caaggtaagaatccgtctttccacactcgagactgatcgagtctacacacattcctatccacttctagttcttcatccaactggggtgaagaaaatggga |
36810422 |
T |
 |
| Q |
201 |
gaaattcaactggctgtaaggtttacttgctcttctctgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36810421 |
gaaattcaactggctgtaaggtttacttgctcttctttgct |
36810381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0305 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0305
Description:
Target: scaffold0305; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 13683 - 13446
Alignment:
| Q |
1 |
tttttgatccgtgcactgtcattacaattggtgtattcgataactgtcacttgcaccatggtggtgataagcctggaggacaaagagattctaaaatcgg |
100 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||| ||||| ||||| ||||| |||| ||| || ||||||| || |||||| | || || |
|
|
| T |
13683 |
tttttgatccttgtactgtgattacaattggtgtatttgataattgtcatttgca---tggtcctgacaaagctggaggtgcaaaagattcaaggattgg |
13587 |
T |
 |
| Q |
101 |
caaggtaagaatccgtctttccacactcgagactgatcgagtctacacacattcctatccacttctagttcttcatccaactggggtgaagaaaatggga |
200 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
13586 |
taaggtaaggattcgtctttcgacactcgagactgatcgagtgtacacacattcctatccactcctagttcttcacccaactggtgtgaagaaaatgggt |
13487 |
T |
 |
| Q |
201 |
gaaattcaactggctgtaaggtttacttgctcttctctgct |
241 |
Q |
| |
|
||||||||| ||||||| ||||| ||||| |||||| |||| |
|
|
| T |
13486 |
gaaattcaattggctgtgaggttcacttgttcttctttgct |
13446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University