View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11956_high_19 (Length: 237)

Name: NF11956_high_19
Description: NF11956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11956_high_19
NF11956_high_19
[»] chr4 (1 HSPs)
chr4 (1-223)||(46470977-46471195)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 46470977 - 46471195
Alignment:
1 aggaggttcctccgaggtagataggtatagtttggcttaagaatggcatggtctctgaaaataactctaggcatggaagccattgattattagacgagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46470977 aggaggttcctccgaggtagataggtatagtttggcttaagaatggcatggtctctgaaaataactctaggcatggaagccattgattattagacgagaa 46471076  T
101 aaggggtttgagtttgaaaagggtttatgaatattcaagaatgagtgagtagggaaattagagtgtgggaatctgaaattgaaaatgagagtgacaagtt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
46471077 aaggggtttgagtttgaaaagggtttatgaatattcaagaatgagtgagtagggaaattagagtgtgggaatctgaaattgaaaatgagagtgacaa--- 46471173  T
201 tgtttgggtgttagtgaagaatt 223  Q
     ||||||||||||||||||||||    
46471174 -gtttgggtgttagtgaagaatt 46471195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University